circad | circRNAs associated with diseases

Circular RNA ABCB10
Gene	ABCB10	Organism	Human
Genome Locus		Build	hg19
Disease	Renal Cell Carcinoma	ICD-10	Malignant neoplasm of kidney, except renal pelvis (C64)
DBLink		PMID	31106654
Experimental Method
Sample Type	Tissue and cell lines	Comparison	ccRCC cell lines compared with the normal kidney cells line
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTGCTGATGACCCTTCCTCTG Reverse GGGAATCCTGAGTGACTTTGGT	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Huang, Y, Zhang, Y, Jia, L, Liu, C, Xu, F (2019). Circular RNA ABCB10 promotes tumor progression and correlates with pejorative prognosis in clear cell renal cell carcinoma. Int. J. Biol. Markers, 34, 2:176-183.